This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
New herbicide options are needed for postemergence (POST) broadleaf weed control in adzuki bean. A field study, of five experiments, was conducted over a three-year period (2014, 2015, 2016) in Ontario to evaluate the...New herbicide options are needed for postemergence (POST) broadleaf weed control in adzuki bean. A field study, of five experiments, was conducted over a three-year period (2014, 2015, 2016) in Ontario to evaluate the tolerance of adzuki bean to the POST application of acifluorfen (600 and 1200 g·ai·ha-1), fomesafen (240 and 480 g·ai·ha-1), bentazon (1080 and 2160 g·ai·ha-1), imazethapyr (100 and 200 g·ai·ha-1) and halosulfuron-methyl (75 and 150 g·ai·ha-1). Acifluorfen and fomesafen applied POST caused as much as 12% visible injury at the 1X rate and 20% visible injury at the 2X rate but had no adverse effect on adzuki bean population, shoot dry weight, height, maturity or yield. Bentazon caused as much as 23% visible injury at 1080 g·ai·ha-1 and 28% visible injury at 2160 g·ai·ha-1 but caused no adverse effect on adzuki bean population, shoot dry weight, height, maturity or yield at either rate, except at 2160 g·ai·ha-1 which reduced shoot dry weight 20% and height 12%. Imazethapyr caused as much as 22% visible injury at 100 g·ai·ha-1 and 34% visible injury at 200 g·ai·ha-1 but caused no adverse effect on adzuki bean population, shoot dry weight, height, maturity or yield at either rate except at 200 g·ai·ha-1 which delayed maturity slightly. Halosulfuron-methyl caused as much as 65% visible injury and reduced shoot dry weight, height and yield 64%, 41%, and 28%, respectively. This research concludes that acfluorfen, fomesafen, bentazon, imazethapyr and halosulfuron at the rates evaluated can cause the significant injury in adzuki bean.展开更多
A set of representative 146 adzuki (Vigna angular is var. angularis, and var. nipponensis) germplasm from 6 Asian countries traditionally for adzuki bean production, together with an out group standard rice bean (Vign...A set of representative 146 adzuki (Vigna angular is var. angularis, and var. nipponensis) germplasm from 6 Asian countries traditionally for adzuki bean production, together with an out group standard rice bean (Vigna umbellata), were analyzed by AFLP methodology using 12 informative primer pairs. 313 unambiguous polymorphic bands were created. According to the dendrogram by cluster analysis based on AFLP banding, 143 of the accessions were distinct and revealed enough genetic diversity for identification and classification of accessions within Vigna angularis. A neighbor joining tree was generated using newly developed Innan's nucleotide diversity estimate from the AFLP data. From analysis, 7 distinct evolutionary groups, named as "Chinese cultivated", "Japanese cultivated", "Japanese complex-Korean cultivated", "Chinese wild", "China Taiwan wild", "Nepal-Bhutan cultivated" and "Hymalayan wild", were detected. Nucleotide diversity with geographical distribution of each group is discussed, regarding the evolutionary relationships between wild and cultivated adzuki beans. The preliminary results indicated that cultivated adzuki bean should be domesticated from at least 4 progenitors in at least 3 geographical origins.展开更多
Adzuki bean(Vigna angularis(Willd.)Ohwi&Ohashi)is an annual cultivated leguminous crop commonly grown in Asia and consumed worldwide.However,there has been limited research regarding adzuki bean genetics,which has...Adzuki bean(Vigna angularis(Willd.)Ohwi&Ohashi)is an annual cultivated leguminous crop commonly grown in Asia and consumed worldwide.However,there has been limited research regarding adzuki bean genetics,which has prevented the efficient application of genes during breeding.In the present study,we constructed a high-density genetic map based on whole genome re-sequencing technology and validated its utility by mining QTLs related to seed size.Moreover,we analyzed the sequences flanking insertions/deletions(In Dels)to develop a set of PCR-based markers useful for characterizing adzuki bean genetics.A total of 2904 markers were mapped to 11 linkage groups(LGs).The total length of the map was 1365.0 cM,with an average distance between markers of 0.47 cM.Among the LGs,the number of markers ranged from 208(LG7)to 397(LG1)and the total distance ranged from 97.4 cM(LG9)to 155.6 cM(LG1).Twelve QTLs related to seed size were identified using the constructed map.The two major QTLs in LG2 and LG9 explained 22.1 and 18.8%of the total phenotypic variation,respectively.Ten minor QTLs in LG4,LG5 and LG6 explained 3.0–10.4%of the total phenotypic variation.A total of 9718 primer pairs were designed based on the sequences flanking In Dels.Among the 200 selected primer pairs,75 revealed polymorphisms in 24 adzuki bean germplasms.The genetic map constructed in this study will be useful for screening genes related to other traits.Furthermore,the QTL analysis of seed size and the novel markers described herein may be relevant for future molecular investigations of adzuki bean and will be useful for exploiting the mechanisms underlying legume seed development.展开更多
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
文摘New herbicide options are needed for postemergence (POST) broadleaf weed control in adzuki bean. A field study, of five experiments, was conducted over a three-year period (2014, 2015, 2016) in Ontario to evaluate the tolerance of adzuki bean to the POST application of acifluorfen (600 and 1200 g·ai·ha-1), fomesafen (240 and 480 g·ai·ha-1), bentazon (1080 and 2160 g·ai·ha-1), imazethapyr (100 and 200 g·ai·ha-1) and halosulfuron-methyl (75 and 150 g·ai·ha-1). Acifluorfen and fomesafen applied POST caused as much as 12% visible injury at the 1X rate and 20% visible injury at the 2X rate but had no adverse effect on adzuki bean population, shoot dry weight, height, maturity or yield. Bentazon caused as much as 23% visible injury at 1080 g·ai·ha-1 and 28% visible injury at 2160 g·ai·ha-1 but caused no adverse effect on adzuki bean population, shoot dry weight, height, maturity or yield at either rate, except at 2160 g·ai·ha-1 which reduced shoot dry weight 20% and height 12%. Imazethapyr caused as much as 22% visible injury at 100 g·ai·ha-1 and 34% visible injury at 200 g·ai·ha-1 but caused no adverse effect on adzuki bean population, shoot dry weight, height, maturity or yield at either rate except at 200 g·ai·ha-1 which delayed maturity slightly. Halosulfuron-methyl caused as much as 65% visible injury and reduced shoot dry weight, height and yield 64%, 41%, and 28%, respectively. This research concludes that acfluorfen, fomesafen, bentazon, imazethapyr and halosulfuron at the rates evaluated can cause the significant injury in adzuki bean.
文摘A set of representative 146 adzuki (Vigna angular is var. angularis, and var. nipponensis) germplasm from 6 Asian countries traditionally for adzuki bean production, together with an out group standard rice bean (Vigna umbellata), were analyzed by AFLP methodology using 12 informative primer pairs. 313 unambiguous polymorphic bands were created. According to the dendrogram by cluster analysis based on AFLP banding, 143 of the accessions were distinct and revealed enough genetic diversity for identification and classification of accessions within Vigna angularis. A neighbor joining tree was generated using newly developed Innan's nucleotide diversity estimate from the AFLP data. From analysis, 7 distinct evolutionary groups, named as "Chinese cultivated", "Japanese cultivated", "Japanese complex-Korean cultivated", "Chinese wild", "China Taiwan wild", "Nepal-Bhutan cultivated" and "Hymalayan wild", were detected. Nucleotide diversity with geographical distribution of each group is discussed, regarding the evolutionary relationships between wild and cultivated adzuki beans. The preliminary results indicated that cultivated adzuki bean should be domesticated from at least 4 progenitors in at least 3 geographical origins.
基金supported by the National Key Research&Development Program of China(2019YFD1001300 and 2019YFD1001303)the earmarked fund for China Agriculture Research System(CARS-08)the Agricultural Science Technology Innovation Program(ASTIP)of Chinese Academy of Agricultural Sciences。
文摘Adzuki bean(Vigna angularis(Willd.)Ohwi&Ohashi)is an annual cultivated leguminous crop commonly grown in Asia and consumed worldwide.However,there has been limited research regarding adzuki bean genetics,which has prevented the efficient application of genes during breeding.In the present study,we constructed a high-density genetic map based on whole genome re-sequencing technology and validated its utility by mining QTLs related to seed size.Moreover,we analyzed the sequences flanking insertions/deletions(In Dels)to develop a set of PCR-based markers useful for characterizing adzuki bean genetics.A total of 2904 markers were mapped to 11 linkage groups(LGs).The total length of the map was 1365.0 cM,with an average distance between markers of 0.47 cM.Among the LGs,the number of markers ranged from 208(LG7)to 397(LG1)and the total distance ranged from 97.4 cM(LG9)to 155.6 cM(LG1).Twelve QTLs related to seed size were identified using the constructed map.The two major QTLs in LG2 and LG9 explained 22.1 and 18.8%of the total phenotypic variation,respectively.Ten minor QTLs in LG4,LG5 and LG6 explained 3.0–10.4%of the total phenotypic variation.A total of 9718 primer pairs were designed based on the sequences flanking In Dels.Among the 200 selected primer pairs,75 revealed polymorphisms in 24 adzuki bean germplasms.The genetic map constructed in this study will be useful for screening genes related to other traits.Furthermore,the QTL analysis of seed size and the novel markers described herein may be relevant for future molecular investigations of adzuki bean and will be useful for exploiting the mechanisms underlying legume seed development.
