Single-strand breaks （SSBs） can occur in cells either directly, or indirectly following initiation of base excision repair （BER）. SSBs generally have blocked termini lacking the conventional 5＇-phosphate and 3＇-...Single-strand breaks （SSBs） can occur in cells either directly, or indirectly following initiation of base excision repair （BER）. SSBs generally have blocked termini lacking the conventional 5＇-phosphate and 3＇-hydroxyl groups and require further processing prior to DNA synthesis and ligation. XRCC1 is devoid of any known enzymatic activity, but it can physically interact with other proteins involved in all stages of the overlapping SSB repair and BER pathways, including those that conduct the rate-limiting end-tailoring, and in many cases can stimulate their enzymatic activities. XRCC1^-/- mouse fibroblasts are most hypersensitive to agents that produce DNA lesions repaired by monofunctional glycosylase-initiated BER and that result in formation of indirect SSBs. A requirement for the deoxyribose phosphate lyase activity of DNA polymerase β （pol β） is specific to this pathway, whereas pol β is implicated in gap-filling during repair of many types of SSBs. Elevated levels of strand breaks, and diminished repair, have been demonstrated in MMS- treated XRCC1^-/-, and to a lesser extent in pol β^-/- cell lines, compared with wild-type cells. Thus a strong correlation is observed between cellular sensitivity to MMS and the ability of cells to repair MMS-induced damage. Exposure of wild-type and polβ^-/- cells to an inhibitor of PARP activity dramatically potentiates MMS-induced cytotoxicity. XRCC1^-/- cells are also sensitized by PARP inhibition demonstrating that PARP-mediated poly（ADP-ribosyl）ation plays a role in modulation of cytotoxicity beyond recruitment of XRCC 1 to sites of DNA damage.展开更多
The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and ter-minal Restriction Fragmen...The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and ter-minal Restriction Fragment Length Polymorphism (tRFLP) combined with 16S rDNA clone library were adopted to investigate the impacts of secretion from Camptotheca acuminata (abbreviated to Ca) roots on the quantities and structure of eukaryotic microbes and bacteria in the rhizosphere, and the possi-bility that Ca controls exotic invasive plant Eupatorium adenophorum (Ea). The counting results indi-cated that the number of bacteria increased in turn in rhizospheres of Ea, Ca-Ea mixed culture and Ca, while that of eukaryotic microbes decreased. PCR-SSCP profiles showed eukaryotic microbial bands (corresponding to biodiversity) in rhizosphere of Ea were more complex than those of Ca and CE. Meristolohmannia sp., Termitomyces sp. and Rhodophyllus sp. were the dominant populations in the rhizosphere of Ca. Bacterial terminal restriction fragments (TRFs) profiles showed no difference among three kinds of rhizospheres, and the sequences of the 16S rDNA clone library from Ca rhizospheres were distributed in 10 known phyla, in which phylum Proteobacteria were the absolute dominant group and accounted for 24.71% of the cloned sequences (δ-Proteobacteria accounted for up to 17.65%), and phyla Acidobacteria and Bacteroidetes accounted for 16.47% and 10.59% of the cloned sequences, respectively. In addition, high performance liquid chromatography detected a trace amount of camp-tothecin and hydroxycamptothecin in the rhizospheric soil of Ca and CE, but examined neither camp-tothecin nor hydroxycamptothecin in rhizospheric soil of Ea. Therefore, invasion and diffusion of Ea evidently depended on distinguishing the eukaryotic community structure, but not on that of the bac-terial pattern. Ca was able to alter the eukaryotic community structure of invasive Ea by secreting camptothecin and hydroxycamptothecin into rhizospheres, and may bene展开更多
Calf thymus DNA was exposed to low-energy heavy ions (N+) and 60Co-γ-rays, and the dose-effect on DNA single-strand breaks (SSB) has been investigated. The results indicate that the dose-effect curve by N+ irradiatio...Calf thymus DNA was exposed to low-energy heavy ions (N+) and 60Co-γ-rays, and the dose-effect on DNA single-strand breaks (SSB) has been investigated. The results indicate that the dose-effect curve by N+ irradiation is different from that of conventional ionizing radiation. While the curve from γ-irradiation follows exponential type, the effect curve produced by N+ ion is of 'saddle type'. The yield of DNASSB per dose unit per DNA unit remained at a certain level under different doses of γ-rays. In contrast, the DNASSB at low dosage region of N+ showed an obvious peak before it decreased rapidly to a lower level.展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
Accumulating evidence indicates that ataxia-telangiectasia mutated kinase is critical for maintaining cellular homeostasis and that it has both nuclear and cytoplasmic functions.However,the functions of ataxia-telangi...Accumulating evidence indicates that ataxia-telangiectasia mutated kinase is critical for maintaining cellular homeostasis and that it has both nuclear and cytoplasmic functions.However,the functions of ataxia-telangiectasia mutated that when lost lead to cerebellar degeneration are still unknown.In this review,we first describe the role of ataxia-telangiectasia mutated in cerebellar pathology.In addition to its canonical nuclear functions in DNA damage response circuits,ataxia-telangiectasia mutated functions in various cytoplasmic and mitochondrial processes that are critically important for cellular homeostasis.We discuss these functions with a focus on the role of ataxia-telangiectasia mutated in maintaining the homeostatic redox state.Finally,we describe the unique functions of ataxia-telangiectasia mutated in various types of neuronal and glial cells including cerebellar granule neurons,astrocytes,and microglial cells.展开更多
Daily insulin injection is necessary for the treatment of the insulin-dependent diabetes. However, the process is painful and inconvenient. Accordingly, we have made exploratory efforts to establish an alternative met...Daily insulin injection is necessary for the treatment of the insulin-dependent diabetes. However, the process is painful and inconvenient. Accordingly, we have made exploratory efforts to establish an alternative method for continuous insulin supply via intramuscular injection of a designed plasmid encoding the single-strand insulin analogue (SIA), which provides safe, effective and prolonged control of insulin-dependent diabetes. To generate a SIA, a short flexible peptide was alternatively introduced into the natural proinsulin to replace its original long and rigid C-peptide. Then, the synthetic promoter SP301 was used to drive potent and specific expression of SIA in skeletal muscle cells. By combining the Pluronic L64 and low-voltage electropulse (L/E), the specialized gene delivery technique was applied to efficiently transfer the constructed plasmid into skeletal muscle cells via intramuscular injection. Through these efforts, a plasmid-based intramuscular gene expression system was established and improved, making it applicable for gene therapy. The plasmid-expressed SIA showed biological functions that were similar to that of natural insulin. A single L/E-pSP301-SIA administration provided sustained SIA expression in vivo for about 1.5 months. In addition, the diabetic mice treated with L/E-pSP301-SIA were much healthier than those with other treatments. This plasmid-based system was safe for the treatment of diabetes and did not cause immune responses or pathological damage. The results confirmed that, in a mouse model, long-term positive effects were achieved by a single intramuscular L/E-pSP301-SIA injection, which consequently provided reliable experimental basis for its clinical application for the treatment of diabetes mellitus with promising prospects.展开更多
The ratios of amino acid to the total amino acids and those of nucleotides to the total nucleotides in genes or genomes are suitable indexes to compare whole gene or genome characteristics based on the large number of...The ratios of amino acid to the total amino acids and those of nucleotides to the total nucleotides in genes or genomes are suitable indexes to compare whole gene or genome characteristics based on the large number of nucleotides rather than their sequences. As these ratios are strictly calculated from nucleotide sequences, the values are independent of experimental errors. In the present mini-review, the following themes are approached according to the ratios of amino acids and nucleotides to their total numbers in the genome: prebiotic evolution, the chronological precedence of protein and codon formations, genome evolution, Chargaff’s second pa- rity rule, and the origins of life. Amino acid formation might have initially occurred during pre- biotic evolution, the “amino acid world”, and amino acid polymerization might chronologically precede codon formation at the end of prebiotic evolution. All nucleotide alterations occurred synchronously over the genome during biolo- gical evolution. After establishing primitive lives, all nucleotide alterations have been governed by linear formulae in nuclear and organelle genomes consisting of the double-stranded DNA. When the four nucleotide contents against each individual nucleotide content in organelles are expressed by four linear regression lines representing the diagonal lines of a 0.5 square – the “Diagonal Genome Universe”, evolution obeys Chargaff’s second parity rule. The fact that linear regression lines intersect at a single point su- ggests that all species originated from a single life source.展开更多
To detect anaerobic bacteria Clostridium sp . and Bacteroides fragilis in intrahepatic stones by molecular genetic method Methods DNA was extracted from 59 stone samples and subjected to polymerase chain rea...To detect anaerobic bacteria Clostridium sp . and Bacteroides fragilis in intrahepatic stones by molecular genetic method Methods DNA was extracted from 59 stone samples and subjected to polymerase chain reaction (PCR) amplification targeting the 16S rRNA gene of Clostridium sp . and the glutamine synthetase gene of Bacteroides fragilis Single-strand conformational polymorphism (SSCP) analysis was performed to identify the Clostridium sp Results 16S rRNA gene sequences for Clostridium sp. were identified in 49 stones (83%, 49/59) The two most common groups were detected in 19 (41%) and 17 (37%) of the 46 samples using SSPC analysis, and 25/59 (42%) stones were tested positive for Bacteroides fragilis Conclusions Anaerobes such as Clostridium sp and Bacteroides fragilis present in intrahepatic stones and may play a role in stone formation PCR is a useful technique to detect fastidious pathogens, which are difficult to culture SSCP of PCR products is a rapid method in differentiating bacterial species展开更多
In order to investigate microbial community structures in different wastewater treatment processes and understand the relationship between the structures and the status of processes,the microbial community diversity,v...In order to investigate microbial community structures in different wastewater treatment processes and understand the relationship between the structures and the status of processes,the microbial community diversity,variety and distribution in five wastewater treatment pro cesses were studied by a culture-independent genetic fingerprinting technique single-strand conformation poly-morphism(SSCP).The five processes included denitrifying and phosphate-removal system(diminished N),Chinese traditional medicine wastewater treatment system(P),beer wastewater treatment system(W),fermentative biohydrogen-producing system(H),and sulfate-reduction system(S).The results indicated that the microbial community profiles in the wastewater bioreactors with the uniform status were very similar.The diversity of microbial populations was correlated with the complexity of organic contaminants in wastewater.Chinese traditional medicine wastewater contained more complex organic components;hence,the population diversity was higher than that of simple nutrient bioreactors fed with molasses wastewater.Compared with the strain bands in a simulated community,the relative proportion of some functional microbial populations in bioreactors was not dom-inant.Fermentative biohydrogen producer Ethanoligenens harbinense in the better condition bioreactor had only a 5% band density,and the Desulfovibrio sp.in the sulfate-reducing bioreactor had less than 1.5%band density.The SSCP profiles could identify the difference in microbial community structures in wastewater treatment processes,monitor some of the functional microbes in these processes,and consequently provide useful guidance for improving their efficiency.展开更多
Several methods of mutation detection, such as single-strand conformation polymorphism (SSCP), tandem SSCP/heteroduplex analysis and SNaPshot analysis were developed using homemade kit on AB1 310 genetic analyzer, and...Several methods of mutation detection, such as single-strand conformation polymorphism (SSCP), tandem SSCP/heteroduplex analysis and SNaPshot analysis were developed using homemade kit on AB1 310 genetic analyzer, and were successfully applied to mutation detection of 31 colorectal tumor samples. The sieving capability of homemade kit and commercial kit were compared, results demonstrate that homemade kit has higher resolution and shorter analysis time. In clinical tumor samples, 26% K-ras (exon 1) and 24% p53 (exons 7–8) were found to have mutations, and all mutations were single point variations. A majority of mutations occurred in one gene, only 1 tumor contained alterations in the two genes, which indicates that development of colorectal cancer lies on alternate pathways, and may correlate with different gene mutations Keywords single nucleotide polymorphism (SNP) - single-strand conformation polymorphism (SSCP) - heteroduplex analysis (HA) - SNaPshot - linear polyacrylamide (LPA) - polydimethylacrylamide (PDMA)展开更多
Objective: To study the relationship between the polymorphism of drug resistant gene rpoB and drug resistance against rifampicin(RFP) of M. tuberculosis L-forms, and to evaluate its clinical application. Methods: A to...Objective: To study the relationship between the polymorphism of drug resistant gene rpoB and drug resistance against rifampicin(RFP) of M. tuberculosis L-forms, and to evaluate its clinical application. Methods: A total of 52 clinical isolated strains of M. tuberculosis L-forms were collected. rpoB gene polymorphism was analyzed by polymerase chain reaction and single-strand conformation polymorphism (PCR-SSCP) and conventional antimicrobial susceptibility test (AST). Their results were compared. Results: AST results showed that 38 of 52 clinical isolated strains were drug resistance (73.08％),while PCR-SSCP indicated 65.38％ (32/52) rpoB gene polymorphism. There was no statistic significance(χ2= 2.4914) between the 2 methods. Conclusion:Combined the application of PCR-SSCP with AST in detecting rpoB drug resistant gene polymorphism of M. tuberculosis L-form from pneumoconiosis patients with tuberculosis may have advantages at earlier diagnosis and guidance of clinical medications.展开更多
Objective： To study the relationship between drug resistant genetic mutation and drug resistance in Mycobacterium tuberculosis L-form, discuss the internal relationship between drug resistances and drug-resistant rel...Objective： To study the relationship between drug resistant genetic mutation and drug resistance in Mycobacterium tuberculosis L-form, discuss the internal relationship between drug resistances and drug-resistant related genes and explore the value of PCR- SSCP to clinical application. Methods： A total of 52 clinically isolated strains of tuberculosis L-form were collected among 97 pneumoconiosis patients complicated with tuberculosis. The gene mutations of katG, rpoB and rpsL were detected by PCR-SSCP, and the results were compared with those analyzed by traditional antimicrobial susceptibility test（AST）. Results： The gene muta- tion rates of katG, rpoB and rpsL by PCR-SSCP were respectively 57.70% （30/52）, 65.38% （32/52） and 40.38% （21/52）. The rate of reversion was 78.85%（41/52） and the result of drag-resistant genes was invariable. The results of AST showed that there were 40 （76.92%） multi-drug resistant strains in 52 clinically isolated strains. The number for three-drug resistant strain was 21 （40.38%） and that of two-drug resistant was 19（36.54%）, but only 12（23.08%） strains were one drug resistant. The rate of total drug-resistance was 100%, but there were 15 strains of allied mutation of three genes, 16 of two mutations and 6 of only one by PCR-SSCP. The coincidences were respectively 71.43%, 84.12% and 50.00%. Then there was no significant difference between the allied mutations of multi-drug resistant gene and the mutations of only one drug resistant gene （P 〉 0.05）. Conclusion： PCR-SSCP technique has a higher sensibility and specificity to detect the genes of katG, rpoB and rpsL in tuberculosis L-form among pneumoconiosis complicated with tuberculosis,and the detecting rate of two drug resistant strains and three drug resistant strains was higher. The combined application of PCR-SSCP and AST has advantages at earlier diagnosis and guidance of clinical medications.展开更多
Abstract Objective To establish a convenient method to detect the genomic population with hepatitis C virus (HCV) at nonstructure 5A (NS5A) region and to determine the correlation between the genomic population compl...Abstract Objective To establish a convenient method to detect the genomic population with hepatitis C virus (HCV) at nonstructure 5A (NS5A) region and to determine the correlation between the genomic population complexity at NS5A region and disease stage. Methods The sera from 52 patients with chronic hepatitis C virus infections were analysed using single strand conformation polymorphism (SSCP). In the SSCP, an asymmetric polymerase chain reaction (PCR) was carried out on the 455 bp products of the first round PCR at the NS5A region and the number of band of single strand deoxyribonucleic acid (DNA) which reacted with complemental DNA probe specific for the NS5A region after gel electrophoresis was analyzed. Results In 90% patients with chronic persistent hepatitis, the bands of single strand DNA was limited to one, and in those with chronic active hepatitis or liver cirrhosis, two or more bands of DNA were frequently detected. In about half of patients with hepatocellularcarcinoma, three or more bands were found. The number of bands increased with the progression of liver disease. The multivariate analysis showed that the progression of liver disease was the independent factor of viral diversity (P<0.025) and was not related to the age, sex, the route of infection and the titer of hepatitis C virus ribonucleic acid (HCV RNA). Conclusion These results suggest that the genomic variability of HCV at NS5A region increases with the progression of liver disease, and this may be closely related to the clinical features of type C liver disease.展开更多
DNA/GO composite plays a significant role in the research field of biotechnology and nanotechnology,and attracts a great deal of interest.However,it is still unclear how the oxidation degree of the graphene-based surf...DNA/GO composite plays a significant role in the research field of biotechnology and nanotechnology,and attracts a great deal of interest.However,it is still unclear how the oxidation degree of the graphene-based surface affects the adsorption process of single-strand DNA(ssDNA).In this paper,based on the molecular dynamics simulations,we find that ssDNA molecule is absorbed on the GO surface in the most stable state with the oxidation degree around 15%.The microscopic mechanism is attributed to the van Der Walls and the electrostatic interactions between the ssDNA molecule and the graphene-based surface,which is accompanied with theπ-πstacking and hydrogen bond formation.The number ofπ-πstacking between ssDNA and GO reaches the maximum value when the oxidation degree is around 15%among all the GO surfaces.Our simulation results also reveal the coexistence of stretched and curved configurations as well as the adsorption orientation of ssDNA on the GO surface.Furthermore,it is found that the absorbed ssDNA molecules are more likely to move on the graphene-based surface of low oxidation degree,especially on pristine graphene.Our work provides the physics picture of ssDNA’s physisorption dynamics onto graphene-based surface and it is helpful in designing DNA/GO nanomaterials.展开更多
AIM:To elucidate the influence of quasispecies on virological response and disease severity in patients with chronic hepatitis C. METHODS:Forty seven patients with hepatitis C [32 with chronic active hepatitis (CAH), ...AIM:To elucidate the influence of quasispecies on virological response and disease severity in patients with chronic hepatitis C. METHODS:Forty seven patients with hepatitis C [32 with chronic active hepatitis (CAH), 9 with cirrhosis, and 6 with hepatocellular carcinoma (HCC)] were screened for the presence of quasispecies by single stranded conformational polymorphism (SSCP) analysis in the hypervariable region (HVR) and non-structural 5B (NS5B) viral genes of hepatitis C virus. The 41 patients excluding those with HCC were on therapy and followed up for a year with the determination of virological response and disease severity. Virus isolated from twenty three randomly selected patients (11 non-responders and 12 showing a sustained virological response) was sequenced for the assessment of mutations. RESULTS:The occurrence of quasispecies was proportionately higher in patients with HCC and cirrhosis than in those with CAH, revealing a significant correlation between the molecular evolution of quasispecies and the severity of disease in patients with hepatitis C. The occurrence of complex quasispecies has a significant association (P < 0.05) with the non-responders, and leads to persistence of infection. Significant differences (P < 0.05) in viral load (log10 IU/mL) were observed among patients infected with complex quasispecies (CQS), those infected with simple quasispecies (SQS) and those with no quasispecies (NQS), after 12 wk (CQS-5.2 ± 2.3, SQS-3.2 ± 1.9, NQS-2.8 ± 2.4) and 24 wk (CQS-3.9 ± 2.2, SQS-3.0 ± 2.2, NQS-2.1 ± 2.3) in the HVR region. However, a statistically significant difference (P < 0.05) was observed between the viral loads of patients infected with CQS and those infected with NQS in NS5B viral gene after 24 wk (CQS-3.9 ± 2.2, SQS-3.0 ± 2.2, and NQS-2.1 ± 2.3) and 48 wk (CQS-3.1 ± 2.7, SQS-2.3 ± 2.4, NQS-2.0 ± 2.3) of therapy. Disease severity was significantly associated with viral load during therapy. The strains isolated from non-responders showed close pairing on phylogeny based展开更多
文摘Single-strand breaks （SSBs） can occur in cells either directly, or indirectly following initiation of base excision repair （BER）. SSBs generally have blocked termini lacking the conventional 5＇-phosphate and 3＇-hydroxyl groups and require further processing prior to DNA synthesis and ligation. XRCC1 is devoid of any known enzymatic activity, but it can physically interact with other proteins involved in all stages of the overlapping SSB repair and BER pathways, including those that conduct the rate-limiting end-tailoring, and in many cases can stimulate their enzymatic activities. XRCC1^-/- mouse fibroblasts are most hypersensitive to agents that produce DNA lesions repaired by monofunctional glycosylase-initiated BER and that result in formation of indirect SSBs. A requirement for the deoxyribose phosphate lyase activity of DNA polymerase β （pol β） is specific to this pathway, whereas pol β is implicated in gap-filling during repair of many types of SSBs. Elevated levels of strand breaks, and diminished repair, have been demonstrated in MMS- treated XRCC1^-/-, and to a lesser extent in pol β^-/- cell lines, compared with wild-type cells. Thus a strong correlation is observed between cellular sensitivity to MMS and the ability of cells to repair MMS-induced damage. Exposure of wild-type and polβ^-/- cells to an inhibitor of PARP activity dramatically potentiates MMS-induced cytotoxicity. XRCC1^-/- cells are also sensitized by PARP inhibition demonstrating that PARP-mediated poly（ADP-ribosyl）ation plays a role in modulation of cytotoxicity beyond recruitment of XRCC 1 to sites of DNA damage.
基金the Excellent Young Teacher’s Innovation Foundation of Northeast Forestry University to Yang FengJian,the Key Research Fund of Ministry of Educa-tion of China (Grant No.104191) the Forestry Noxious Plant Investigation Fund of State Forestry Administration of China to Zu YuanGang
文摘The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and ter-minal Restriction Fragment Length Polymorphism (tRFLP) combined with 16S rDNA clone library were adopted to investigate the impacts of secretion from Camptotheca acuminata (abbreviated to Ca) roots on the quantities and structure of eukaryotic microbes and bacteria in the rhizosphere, and the possi-bility that Ca controls exotic invasive plant Eupatorium adenophorum (Ea). The counting results indi-cated that the number of bacteria increased in turn in rhizospheres of Ea, Ca-Ea mixed culture and Ca, while that of eukaryotic microbes decreased. PCR-SSCP profiles showed eukaryotic microbial bands (corresponding to biodiversity) in rhizosphere of Ea were more complex than those of Ca and CE. Meristolohmannia sp., Termitomyces sp. and Rhodophyllus sp. were the dominant populations in the rhizosphere of Ca. Bacterial terminal restriction fragments (TRFs) profiles showed no difference among three kinds of rhizospheres, and the sequences of the 16S rDNA clone library from Ca rhizospheres were distributed in 10 known phyla, in which phylum Proteobacteria were the absolute dominant group and accounted for 24.71% of the cloned sequences (δ-Proteobacteria accounted for up to 17.65%), and phyla Acidobacteria and Bacteroidetes accounted for 16.47% and 10.59% of the cloned sequences, respectively. In addition, high performance liquid chromatography detected a trace amount of camp-tothecin and hydroxycamptothecin in the rhizospheric soil of Ca and CE, but examined neither camp-tothecin nor hydroxycamptothecin in rhizospheric soil of Ea. Therefore, invasion and diffusion of Ea evidently depended on distinguishing the eukaryotic community structure, but not on that of the bac-terial pattern. Ca was able to alter the eukaryotic community structure of invasive Ea by secreting camptothecin and hydroxycamptothecin into rhizospheres, and may bene
文摘Calf thymus DNA was exposed to low-energy heavy ions (N+) and 60Co-γ-rays, and the dose-effect on DNA single-strand breaks (SSB) has been investigated. The results indicate that the dose-effect curve by N+ irradiation is different from that of conventional ionizing radiation. While the curve from γ-irradiation follows exponential type, the effect curve produced by N+ ion is of 'saddle type'. The yield of DNASSB per dose unit per DNA unit remained at a certain level under different doses of γ-rays. In contrast, the DNASSB at low dosage region of N+ showed an obvious peak before it decreased rapidly to a lower level.
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
文摘Accumulating evidence indicates that ataxia-telangiectasia mutated kinase is critical for maintaining cellular homeostasis and that it has both nuclear and cytoplasmic functions.However,the functions of ataxia-telangiectasia mutated that when lost lead to cerebellar degeneration are still unknown.In this review,we first describe the role of ataxia-telangiectasia mutated in cerebellar pathology.In addition to its canonical nuclear functions in DNA damage response circuits,ataxia-telangiectasia mutated functions in various cytoplasmic and mitochondrial processes that are critically important for cellular homeostasis.We discuss these functions with a focus on the role of ataxia-telangiectasia mutated in maintaining the homeostatic redox state.Finally,we describe the unique functions of ataxia-telangiectasia mutated in various types of neuronal and glial cells including cerebellar granule neurons,astrocytes,and microglial cells.
基金supported by the National Natural Science Foundation of China(No.31971390)the International Cooperative Project of Sichuan Province on Science and Technology Innovation(China)(No.2021YFH0142).
文摘Daily insulin injection is necessary for the treatment of the insulin-dependent diabetes. However, the process is painful and inconvenient. Accordingly, we have made exploratory efforts to establish an alternative method for continuous insulin supply via intramuscular injection of a designed plasmid encoding the single-strand insulin analogue (SIA), which provides safe, effective and prolonged control of insulin-dependent diabetes. To generate a SIA, a short flexible peptide was alternatively introduced into the natural proinsulin to replace its original long and rigid C-peptide. Then, the synthetic promoter SP301 was used to drive potent and specific expression of SIA in skeletal muscle cells. By combining the Pluronic L64 and low-voltage electropulse (L/E), the specialized gene delivery technique was applied to efficiently transfer the constructed plasmid into skeletal muscle cells via intramuscular injection. Through these efforts, a plasmid-based intramuscular gene expression system was established and improved, making it applicable for gene therapy. The plasmid-expressed SIA showed biological functions that were similar to that of natural insulin. A single L/E-pSP301-SIA administration provided sustained SIA expression in vivo for about 1.5 months. In addition, the diabetic mice treated with L/E-pSP301-SIA were much healthier than those with other treatments. This plasmid-based system was safe for the treatment of diabetes and did not cause immune responses or pathological damage. The results confirmed that, in a mouse model, long-term positive effects were achieved by a single intramuscular L/E-pSP301-SIA injection, which consequently provided reliable experimental basis for its clinical application for the treatment of diabetes mellitus with promising prospects.
文摘The ratios of amino acid to the total amino acids and those of nucleotides to the total nucleotides in genes or genomes are suitable indexes to compare whole gene or genome characteristics based on the large number of nucleotides rather than their sequences. As these ratios are strictly calculated from nucleotide sequences, the values are independent of experimental errors. In the present mini-review, the following themes are approached according to the ratios of amino acids and nucleotides to their total numbers in the genome: prebiotic evolution, the chronological precedence of protein and codon formations, genome evolution, Chargaff’s second pa- rity rule, and the origins of life. Amino acid formation might have initially occurred during pre- biotic evolution, the “amino acid world”, and amino acid polymerization might chronologically precede codon formation at the end of prebiotic evolution. All nucleotide alterations occurred synchronously over the genome during biolo- gical evolution. After establishing primitive lives, all nucleotide alterations have been governed by linear formulae in nuclear and organelle genomes consisting of the double-stranded DNA. When the four nucleotide contents against each individual nucleotide content in organelles are expressed by four linear regression lines representing the diagonal lines of a 0.5 square – the “Diagonal Genome Universe”, evolution obeys Chargaff’s second parity rule. The fact that linear regression lines intersect at a single point su- ggests that all species originated from a single life source.
文摘To detect anaerobic bacteria Clostridium sp . and Bacteroides fragilis in intrahepatic stones by molecular genetic method Methods DNA was extracted from 59 stone samples and subjected to polymerase chain reaction (PCR) amplification targeting the 16S rRNA gene of Clostridium sp . and the glutamine synthetase gene of Bacteroides fragilis Single-strand conformational polymorphism (SSCP) analysis was performed to identify the Clostridium sp Results 16S rRNA gene sequences for Clostridium sp. were identified in 49 stones (83%, 49/59) The two most common groups were detected in 19 (41%) and 17 (37%) of the 46 samples using SSPC analysis, and 25/59 (42%) stones were tested positive for Bacteroides fragilis Conclusions Anaerobes such as Clostridium sp and Bacteroides fragilis present in intrahepatic stones and may play a role in stone formation PCR is a useful technique to detect fastidious pathogens, which are difficult to culture SSCP of PCR products is a rapid method in differentiating bacterial species
基金This work was supported by the National Natural Science Foundation of China(Grant Nos.:50208006,30470054 and 50678049)China Postdoctoral Science Foundation(Grant No.:20070410266).
文摘In order to investigate microbial community structures in different wastewater treatment processes and understand the relationship between the structures and the status of processes,the microbial community diversity,variety and distribution in five wastewater treatment pro cesses were studied by a culture-independent genetic fingerprinting technique single-strand conformation poly-morphism(SSCP).The five processes included denitrifying and phosphate-removal system(diminished N),Chinese traditional medicine wastewater treatment system(P),beer wastewater treatment system(W),fermentative biohydrogen-producing system(H),and sulfate-reduction system(S).The results indicated that the microbial community profiles in the wastewater bioreactors with the uniform status were very similar.The diversity of microbial populations was correlated with the complexity of organic contaminants in wastewater.Chinese traditional medicine wastewater contained more complex organic components;hence,the population diversity was higher than that of simple nutrient bioreactors fed with molasses wastewater.Compared with the strain bands in a simulated community,the relative proportion of some functional microbial populations in bioreactors was not dom-inant.Fermentative biohydrogen producer Ethanoligenens harbinense in the better condition bioreactor had only a 5% band density,and the Desulfovibrio sp.in the sulfate-reducing bioreactor had less than 1.5%band density.The SSCP profiles could identify the difference in microbial community structures in wastewater treatment processes,monitor some of the functional microbes in these processes,and consequently provide useful guidance for improving their efficiency.
文摘Several methods of mutation detection, such as single-strand conformation polymorphism (SSCP), tandem SSCP/heteroduplex analysis and SNaPshot analysis were developed using homemade kit on AB1 310 genetic analyzer, and were successfully applied to mutation detection of 31 colorectal tumor samples. The sieving capability of homemade kit and commercial kit were compared, results demonstrate that homemade kit has higher resolution and shorter analysis time. In clinical tumor samples, 26% K-ras (exon 1) and 24% p53 (exons 7–8) were found to have mutations, and all mutations were single point variations. A majority of mutations occurred in one gene, only 1 tumor contained alterations in the two genes, which indicates that development of colorectal cancer lies on alternate pathways, and may correlate with different gene mutations Keywords single nucleotide polymorphism (SNP) - single-strand conformation polymorphism (SSCP) - heteroduplex analysis (HA) - SNaPshot - linear polyacrylamide (LPA) - polydimethylacrylamide (PDMA)
文摘Objective: To study the relationship between the polymorphism of drug resistant gene rpoB and drug resistance against rifampicin(RFP) of M. tuberculosis L-forms, and to evaluate its clinical application. Methods: A total of 52 clinical isolated strains of M. tuberculosis L-forms were collected. rpoB gene polymorphism was analyzed by polymerase chain reaction and single-strand conformation polymorphism (PCR-SSCP) and conventional antimicrobial susceptibility test (AST). Their results were compared. Results: AST results showed that 38 of 52 clinical isolated strains were drug resistance (73.08％),while PCR-SSCP indicated 65.38％ (32/52) rpoB gene polymorphism. There was no statistic significance(χ2= 2.4914) between the 2 methods. Conclusion:Combined the application of PCR-SSCP with AST in detecting rpoB drug resistant gene polymorphism of M. tuberculosis L-form from pneumoconiosis patients with tuberculosis may have advantages at earlier diagnosis and guidance of clinical medications.
基金This work was supported by the Youth Natural Science Foundation of Anhui University of Science & Technology(200537)
文摘Objective： To study the relationship between drug resistant genetic mutation and drug resistance in Mycobacterium tuberculosis L-form, discuss the internal relationship between drug resistances and drug-resistant related genes and explore the value of PCR- SSCP to clinical application. Methods： A total of 52 clinically isolated strains of tuberculosis L-form were collected among 97 pneumoconiosis patients complicated with tuberculosis. The gene mutations of katG, rpoB and rpsL were detected by PCR-SSCP, and the results were compared with those analyzed by traditional antimicrobial susceptibility test（AST）. Results： The gene muta- tion rates of katG, rpoB and rpsL by PCR-SSCP were respectively 57.70% （30/52）, 65.38% （32/52） and 40.38% （21/52）. The rate of reversion was 78.85%（41/52） and the result of drag-resistant genes was invariable. The results of AST showed that there were 40 （76.92%） multi-drug resistant strains in 52 clinically isolated strains. The number for three-drug resistant strain was 21 （40.38%） and that of two-drug resistant was 19（36.54%）, but only 12（23.08%） strains were one drug resistant. The rate of total drug-resistance was 100%, but there were 15 strains of allied mutation of three genes, 16 of two mutations and 6 of only one by PCR-SSCP. The coincidences were respectively 71.43%, 84.12% and 50.00%. Then there was no significant difference between the allied mutations of multi-drug resistant gene and the mutations of only one drug resistant gene （P 〉 0.05）. Conclusion： PCR-SSCP technique has a higher sensibility and specificity to detect the genes of katG, rpoB and rpsL in tuberculosis L-form among pneumoconiosis complicated with tuberculosis,and the detecting rate of two drug resistant strains and three drug resistant strains was higher. The combined application of PCR-SSCP and AST has advantages at earlier diagnosis and guidance of clinical medications.
文摘Abstract Objective To establish a convenient method to detect the genomic population with hepatitis C virus (HCV) at nonstructure 5A (NS5A) region and to determine the correlation between the genomic population complexity at NS5A region and disease stage. Methods The sera from 52 patients with chronic hepatitis C virus infections were analysed using single strand conformation polymorphism (SSCP). In the SSCP, an asymmetric polymerase chain reaction (PCR) was carried out on the 455 bp products of the first round PCR at the NS5A region and the number of band of single strand deoxyribonucleic acid (DNA) which reacted with complemental DNA probe specific for the NS5A region after gel electrophoresis was analyzed. Results In 90% patients with chronic persistent hepatitis, the bands of single strand DNA was limited to one, and in those with chronic active hepatitis or liver cirrhosis, two or more bands of DNA were frequently detected. In about half of patients with hepatocellularcarcinoma, three or more bands were found. The number of bands increased with the progression of liver disease. The multivariate analysis showed that the progression of liver disease was the independent factor of viral diversity (P<0.025) and was not related to the age, sex, the route of infection and the titer of hepatitis C virus ribonucleic acid (HCV RNA). Conclusion These results suggest that the genomic variability of HCV at NS5A region increases with the progression of liver disease, and this may be closely related to the clinical features of type C liver disease.
基金supported by the National Natural Science Foundation of China(Grant Nos.11305237 and 11974366)the Fundamental Research Funds for the Central Universities,China,the Natural Science Foundation of Shanghai,China(Grant No.19ZR1463200)the Key Research Program of Chinese Academy of Sciences(Grant No.QYZDJ-SSW-SLH053).
文摘DNA/GO composite plays a significant role in the research field of biotechnology and nanotechnology,and attracts a great deal of interest.However,it is still unclear how the oxidation degree of the graphene-based surface affects the adsorption process of single-strand DNA(ssDNA).In this paper,based on the molecular dynamics simulations,we find that ssDNA molecule is absorbed on the GO surface in the most stable state with the oxidation degree around 15%.The microscopic mechanism is attributed to the van Der Walls and the electrostatic interactions between the ssDNA molecule and the graphene-based surface,which is accompanied with theπ-πstacking and hydrogen bond formation.The number ofπ-πstacking between ssDNA and GO reaches the maximum value when the oxidation degree is around 15%among all the GO surfaces.Our simulation results also reveal the coexistence of stretched and curved configurations as well as the adsorption orientation of ssDNA on the GO surface.Furthermore,it is found that the absorbed ssDNA molecules are more likely to move on the graphene-based surface of low oxidation degree,especially on pristine graphene.Our work provides the physics picture of ssDNA’s physisorption dynamics onto graphene-based surface and it is helpful in designing DNA/GO nanomaterials.
基金Indian Council of Medical Research No. 485/2003/ECD-I, New Delhi, India
文摘AIM:To elucidate the influence of quasispecies on virological response and disease severity in patients with chronic hepatitis C. METHODS:Forty seven patients with hepatitis C [32 with chronic active hepatitis (CAH), 9 with cirrhosis, and 6 with hepatocellular carcinoma (HCC)] were screened for the presence of quasispecies by single stranded conformational polymorphism (SSCP) analysis in the hypervariable region (HVR) and non-structural 5B (NS5B) viral genes of hepatitis C virus. The 41 patients excluding those with HCC were on therapy and followed up for a year with the determination of virological response and disease severity. Virus isolated from twenty three randomly selected patients (11 non-responders and 12 showing a sustained virological response) was sequenced for the assessment of mutations. RESULTS:The occurrence of quasispecies was proportionately higher in patients with HCC and cirrhosis than in those with CAH, revealing a significant correlation between the molecular evolution of quasispecies and the severity of disease in patients with hepatitis C. The occurrence of complex quasispecies has a significant association (P < 0.05) with the non-responders, and leads to persistence of infection. Significant differences (P < 0.05) in viral load (log10 IU/mL) were observed among patients infected with complex quasispecies (CQS), those infected with simple quasispecies (SQS) and those with no quasispecies (NQS), after 12 wk (CQS-5.2 ± 2.3, SQS-3.2 ± 1.9, NQS-2.8 ± 2.4) and 24 wk (CQS-3.9 ± 2.2, SQS-3.0 ± 2.2, NQS-2.1 ± 2.3) in the HVR region. However, a statistically significant difference (P < 0.05) was observed between the viral loads of patients infected with CQS and those infected with NQS in NS5B viral gene after 24 wk (CQS-3.9 ± 2.2, SQS-3.0 ± 2.2, and NQS-2.1 ± 2.3) and 48 wk (CQS-3.1 ± 2.7, SQS-2.3 ± 2.4, NQS-2.0 ± 2.3) of therapy. Disease severity was significantly associated with viral load during therapy. The strains isolated from non-responders showed close pairing on phylogeny based
